Prevalence of Campylobacter fetus subsp. venerealis in Dairy Cows from Brejo Paraibano, Brazil
DOI:
https://doi.org/10.22456/1679-9216.81811Resumo
Background: Bovine genital campylobacteriosis (BGC) results in an increase in the interval between calving, increase in age at first calving, increase in the number of doses of semen or services by conception, and reduction in the number of animals born and weaned. Due to the importance of cattle breeding in Brazil, to the impact of BGC on bovine reproductive health, and since campylobacteriosis has never been studied in this region of Brazil, epidemiological studies on C. fetus infection in bovine herds are essential. The objective of this study was to determine prevalence of Campylobacter fetus subsp. venerealis infection in dairy cows from the Brejo Paraibano region, northeastern Brazil.
Materials, Methods & Results: A cross-sectional study was conducted to determine prevalence of animals infected by C. fetus subsp. venerealis. In order to compose the sample of the number of farms, a total of 30 farming establishments with milk cattle and expected prevalence of 1.8%, 95% confidence interval (CI) and statistical error of 5% were considered, which provided a minimum of 15 farms. Samples of cervico-vaginal mucus were collected from 273 dairy cows from 19 farms. Polymerase chain reaction was used for laboratory diagnosis using the oligonucleotides VENSF1 (5’CTTAGCAGTTTGCGATATTGCCATT3’) and VENS2 (5’GCTTTTGAGATAACAATAAGAGCTT3’) for detection of a 142 base-pairs product. In order to confirm the results, positive samples were purified after amplification and bidirectional sequenced. A thematic map was prepared with prevalence distributions in the studied area. The prevalence of C. fetus subsp. venerealis infection in cows was 7.7% (confidence interval [CI] 95%, 4.8%-11.5%), and 31.6% (6/19) of the farms showed at least one positive animal. Of the six counties surveyed, all (100.0%) had positive animals, with a positive farm per county. Regarding age, it was observed that all positive animals were between two and 15 years old, with a mean age of 6.2 years.
Discussion: This is the first report of C. fetus subsp. venerealis infection in dairy cows in this region of Brazil. In this microregion, 7.7% (21) were positive in the PCR. Considering only the samples of females, in Brazil a result close to that of the present study was obtained in the Federal District and Goiás, where a prevalence of 10.5% (27/258) was determined using direct immunofluorescence (DIF) in samples of uterine and vaginal swabs from animals slaughtered in slaughter houses. However, the prevalence observed in the present study was lower than that generally reported, including in other regions of the country. In Minas Gerais, a prevalence of 25.5% (40/157) was found using DIF in samples of cervical-vaginal mucus from cows from herds with reproductive problems. In the state of Rio Grande do Sul, 13.6% of samples from cows were PCR positive. The use of high sensitivity tests, such as PCR, which can detect a small number of microorganisms, is important in studies of this nature. The prevalence of farms with positive animals, associated with the detection of infection in cattle of all the counties surveyed, makes it possible to affirm that C. fetus subsp. venerealis infection is present in cattle in the Brejo Paraibano microregion. This study demonstrates the presence of C. fetus subsp. venerealis DNA in dairy cows in the surveyed region. It is recommended to adopt an artificial insemination program on the farms, as well as a vaccination program to stimulate immunity in order to reduce the occurrence of infection and possible reproductive problems.
Downloads
Referências
Alves T.M., Stynen A.P.R., Miranda K.L. & Lage A.P. 2011. Campilobacteriose genital bovina e tricomonose genital bovina: epidemiologia, diagnóstico e controle. Pesquisa Veterinária Brasileira. 31: 336-344.
Brasil. 2006. Ministério de Ciência e Tecnologia. Instituto Nacional de Pesquisas Espaciais. TerraView version 3.1.3. Disponível em: <http://www.dpi.inpe.br/terraview/index.php>. [Accessed online in August 2015].
Griffiths I.B., Gallego M.I. & de Leon L.S. 1984. Levels of some Reproductive Diseases in the Dairy Cattle of Colombia. Tropical Animal Health and Production. 16: 219-223.
Groff A.C.M., Kirinus J.K., Silva M.S., Machado G., Costa M.M. & Vargas A.P.C. 2010. Polymerase chain reaction for the diagnosis of bovine genital campylobacteriosis. Pesquisa Veterinária Brasileira. 30: 1031-1035.
Hum S., Quinn K., Brunner B. & On S.L.W. 1997. Evaluation of a PCR assay for identification and differentiation of Campylobacter fetus subspecies. Australian Veterinary Journal. 17: 827-831.
Instituto Brasileiro de Geografia e Estatística (IBGE). 2006. Sistema IBGE de Recuperação Automática – SIDRA. Pesquisa Censo Agropecuário 2006. Rio de Janeiro. Disponível em: <http://www.sidra.ibge.gov.br/bda/tabela/listabl. asp?c=1267&z=t&o=24/>. [Accessed online in September 2016]. 7 Instituto Brasileiro de Geografia e Estatística (IBGE). 2016. Rio de Janeiro. Disponível em: <http://www.ibge.gov. br/>]. [Accessed online in September 2016].
Jimenez D.F., Perez A.M., Carpenter T.E. & Martinez A. 2011. Factors associated with infection by Campylobacter fetus in beef herds in the Province of Buenos Aires, Argentina. Preventive Veterinary Medicine. 101: 157-162.
Junqueira J.R.C. & Alfieri A.A. 2006. Falhas da reprodução na pecuária bovina de corte com ênfase para causas infecciosas. Semina, Ciências Agrárias. 27: 289-298.
Leal D.R., Fernandes G.O., Gouveia F.F., Miranda K.L. & Neves J.P. 2012. Prevalência da campilobacteriose e da tricomonose genitais bovinas no Distrito Federal e em seu entorno. Revista Brasileira de Reprodução Animal. 36: 256-259.
Madoroba E., Gelaw A., Hlokwe T. & Mnisi M. 2011. Prevalence of Campylobacter foetus and Trichomonas foetus among cattle from Southern Africa. African Journal of Biotechnology. 10: 10311-10314.
Mai H.M., Irons P.C., Kabir J. & Thompson P.N. 2013. Herd-level risk factors for Campylobacter fetus infection, Brucella seropositivity and within-herd seroprevalence of brucellosis in cattle in northern Nigeria. Preventive Veterinary Medicine. 111: 256-267.
Mai H.M., Irons P.C., Kabir J. & Thompson P.N. 2013. Prevalence of bovine genital campylobacteriosis and trichomonosis of bulls in northern Nigeria. Acta Veterinaria Scandinavica. 55: 56.
McMillen L., Fordyce G., Doogan V.J. & Lew A.E. 2006. Comparison of culture and a novel 5’ Taq nuclease assay for direct detection of Campylobacter fetus subsp. venerealis in clinical specimens from cattle. Journal of Clinical Microbiology. 44: 938-945.
Mendoza-Ibarra J.A., Pedraza-Díaz S., García-Peña F.J., Rojo-Montejo S., Ruiz-Santa-Quiteria J.A., MiguelIbáñez E.S., Navarro-Lozano V., Ortega-Mora L.M., Osoro K. & Collantes-Fernandez E. 2012. High prevalence of Tritrichomonas foetus infection in Asturiana de la Montaña beef cattle kept in extensive conditions in Northern Spain. The Veterinary Journal. 193: 146-151.
Molina L., Perea J., Meglia G., Angón E. & García A. 2013. Spatial and temporal epidemiology of bovine trichomoniasis and bovine genital campylobacteriosis in La Pampa province (Argentina). Preventive Veterinary Medicine. 110: 388-394.
Monke H.J., Love B.C., Wittum T.E., Monke D.R. & Byrum B.A. 2002. Effect of transport enrichment medium, transport time, and growth medium on the detection of Campylobacter fetus subsp. venerealis. Journal of Veterinary Diagnostic Investigation. 14: 35-39.
Mshelia G.D., Amin J.D., Woldehiwet Z., Murray R.D. & Egwu G.O. 2010. Epidemiology of bovine venereal campylobacteriosis: geographic distribution and recent advances in molecular diagnostic techniques. Reproduction in Domestic Animals. 45: e221-e230. doi: 10.1111/j.1439-0531.2009.01546.
OIE - World Organization for Animal Health. 2016. Bovine genital campylobacteriosis, disease timelines. In: WAHIS Interface. Disponível em: <http://www.oie.int/>. [Accessed online in September 2016].
Oliveira Filho R.B., Malta K.C., Santana V.L.A., Harrop M.H.V., Stipp D.T., Brandespim D.F., Mota R.A. & Pinheiro Júnior J.W. 2014. Spatial characterization of Leptospira spp. infection in equids from the Brejo Paraibano microregion in Brazil. Geospatial Health. 8: 463-469.
Oliveira J.M.B., Silva G.M., Batista Filho A.F.B., Borges J.M., Oliveira P.R.F., Brandespim D.F., Mota R.A. & Pinheiro Júnior J.W. 2015. Prevalence and risk factors associated with bovine genital campylobacteriosis and bovine trichomonosis in the state of Pernambuco, Brazil. Tropical Animal Health and Production. 47: 549-555.
Pellegrin A.O., Lage A.P., Sereno J.R.B., Ravaglia E., Costa M.S. & Leite R.C. 2002. Bovine genital campylobacteriosis in Pantanal, state of Mato Grosso do Sul, Brazil. Revue d’Élevage et de Médecine Vétérinaire des Pays Tropicaux. 55: 169-173.
Pellegrin A.O., Leite R.C., Sereno J.R.B., Reinato A.P.R. & Lage A.P. 1999. Prevalência da campilobacteriose genital bovina em touros nelore do Pantanal Mato-Grossense. Comunicado técnico Embrapa. 23: 1-8.
Stynen A.P.R., Pellegrin A.O., Fóscolo C.B., Figueiredo J.F., Canella Filho C., Leite R.C. & Lage A.P. 2003. Campilobacteriose genital bovina em rebanhos leiteiros com problemas reprodutivos da microrregião de Varginha - Minas Gerais. Arquivo Brasileiro de Medicina Veterinária e Zootecnia. 55: 766-769.
Ziech R.E., Machado G., Kirinus J.K., Libardoni F., Kessler J.D., Pötter L. & Vargas A.C. 2014. Campylobacter fetus em bovinos no estado do Rio Grande do Sul. Ciência Rural. 44: 141-146.
Publicado
Como Citar
Edição
Seção
Licença
This journal provides open access to all of its content on the principle that making research freely available to the public supports a greater global exchange of knowledge. Such access is associated with increased readership and increased citation of an author's work. For more information on this approach, see the Public Knowledge Project and Directory of Open Access Journals.
We define open access journals as journals that use a funding model that does not charge readers or their institutions for access. From the BOAI definition of "open access" we take the right of users to "read, download, copy, distribute, print, search, or link to the full texts of these articles" as mandatory for a journal to be included in the directory.
La Red y Portal Iberoamericano de Revistas Científicas de Veterinaria de Libre Acceso reúne a las principales publicaciones científicas editadas en España, Portugal, Latino América y otros países del ámbito latino